FACTOID # 19: Cheap sloppy joes: Looking for reduced-price lunches for schoolchildren? Head for Oklahoma!
 
 Home   Encyclopedia   Statistics   States A-Z   Flags   Maps   FAQ   About 
   
 
WHAT'S NEW
 

SEARCH ALL

FACTS & STATISTICS    Advanced view

Search encyclopedia, statistics and forums:

 

 

(* = Graphable)

 

 


Encyclopedia > Hairpin loop
Hairpin structure of RNA
Hairpin structure of RNA

A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop. Image File history File links Download high resolution version (500x800, 26 KB)A diagram of a hairpin loop in RNA Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1. ... Image File history File links Download high resolution version (500x800, 26 KB)A diagram of a hairpin loop in RNA Permission is granted to copy, distribute and/or modify this document under the terms of the GNU Free Documentation License, Version 1. ... Ribonucleic acid (RNA) is a nucleic acid polymer consisting of covalently bound nucleotides. ... A nucleotide is a monomer or the structural unit of nucleotide chains forming nucleic acids as RNA and DNA. A nucleotide consists of a heterocyclic nucleobase, a pentose sugar (ribose or deoxiribose), and a phosphate or polyphosphate group. ...


An example of a 5' → 3' sequence of RNA which would lead to a hairpin loop structure is:


GCCGCGGGCCGAAAAAACCCCCCCGGCCCGCGGC


The above sequence is an example of dyad symmetry, where the bases downstream are complementary to the bases upstream and so they form base pairs. In genetics, dyad symmetry refers to two areas of a DNA molecule whose base pair sequences are repeats of each other, inverted relative to each other, or are palindromes. ... In molecular biology, two nucleotides on opposite complementary DNA or RNA strands that are connected via hydrogen bonds are called a base pair (often abbreviated bp). ...



Hairpin loops are important in prokaryotic transcription termination. The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand. This process is known as rho-independent or intrinsic termination. Prokaryotes are unicellular (in rare cases, multicellular) organisms without a nucleus. ... Transcription may be one of the following: In linguistics, transcription is the conversion of spoken words into written language. ... Termination as a technical term has different meanings. ...


  Results from FactBites:
 
Hairpin loop - Definition, explanation (146 words)
A hairpin loop in RNA is a sequence of nucleotides where a long segment of RNA can base-pair with each other, but a segment within that sequence can not base pair, causing a hairpin loop.
Hairpin loops are important in prokaryotic transcription termination.
The hairpin loop forms during transcription and the structure causes the RNA polymerase to become dissociated from the DNA template strand.
  More results at FactBites »

 
 

COMMENTARY     


Share your thoughts, questions and commentary here
Your name
Your comments

Want to know more?
Search encyclopedia, statistics and forums:

 


Press Releases |  Feeds | Contact
The Wikipedia article included on this page is licensed under the GFDL.
Images may be subject to relevant owners' copyright.
All other elements are (c) copyright NationMaster.com 2003-5. All Rights Reserved.
Usage implies agreement with terms, 1022, m