FACTOID # 29: 73.3% of America's gross operating surplus in motion picture and sound recording industries comes from California.
 
 Home   Encyclopedia   Statistics   States A-Z   Flags   Maps   FAQ   About 
   
 
WHAT'S NEW
 

SEARCH ALL

FACTS & STATISTICS    Advanced view

Search encyclopedia, statistics and forums:

 

 

(* = Graphable)

 

 


Encyclopedia > Guide RNA

Guide RNA (gRNA) is a type of RNA that is used in mRNA editing. // Introduction The term RNA editing describes those molecular processes in which the information content is altered in a RNA molecule through a chemical change in the base makeup. ...


Overview of gRNA-mediated editing

The mitochondria for some trypanosome protozoa undergo gRNA-mediated mRNA editing. The gRNA identifies particular sequences and inserts or deletes Uridine (U) nucleotides. The edited portion of the mRNA is in the coding region, which has the effect of modifying the protein that is produced. Genera Blastocrithidia Crithidia Endotrypanum Herpetomonas Leishmania Leptomonas Phytomonas Trypanosoma Wallaceina Trypanosomes are a group of kinetoplastid protozoa distinguished by having only a single flagellum. ...


Example of gRNA-mediated editing

In the protozoan, Leishmania tarentolae, some mitochondrial genes are edited using this process. One such gene is Cyb.[1] While the exact sequence of events is still understudy, one model has that the mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is Species see text Leishmania is a genus of trypanosome protozoa, and is the parasite responsible for the disease leishmaniasis. ...

 mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3' 

The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) with normal basepairing (some G/U pairs are used). The 5' end does not exactly match and an endonuclease makes cuts in the mRNA to allow for alignment.

 gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3' 

The mRNA is now "repaired" by adding U, giving the sequence

 gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5' mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3' 

This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA).


Notes

  1. ^ See [1] (Accessed 19 May 2006) for details.

  Results from FactBites:
 
RNA Editing (1387 words)
Post-transcriptional modification, otherwise known as RNA editing, is a mechanism that the transcribed mRNA molecules undergo to be able to leave the nucleus and function correctly in the cell.
This type of RNA editing is important for the survival of the bloodstream form of Trypanosoma brucei, because many proteins are transcribed in the mitochondria that are needed for the survival of the trypanosome.
The addition of the spliced leader RNA is important because the cap of the spliced leader is essential in directing mRNAs to the various pathways that process and transport mRNA molecules outside of the cell nucleus.
Exploration Guide: RNA and Protein Synthesis Gizmo | ExploreLearning (692 words)
RNA, which stands for ribonucleic acid, decodes sections of DNA for the synthesis of proteins.
Single-stranded RNA molecules are created along sections of the DNA molecule, leave the nucleus, and are transported to the ribosomes.
At the completion of RNA transcription, the new strand of RNA leaves the nucleus of the cell.
  More results at FactBites »

 
 

COMMENTARY     


Share your thoughts, questions and commentary here
Your name
Your comments

Want to know more?
Search encyclopedia, statistics and forums:

 


Press Releases |  Feeds | Contact
The Wikipedia article included on this page is licensed under the GFDL.
Images may be subject to relevant owners' copyright.
All other elements are (c) copyright NationMaster.com 2003-5. All Rights Reserved.
Usage implies agreement with terms, 1022, m